Identification of polymorphisms of XRCC1 gene in patients with cancer in a city of northern Brazil

Universidade Federal do Amapá (UNIFAP)

DOI:10.5935/1676-2444.20150024

Corresponding author

Artemis Socorro N. Rodrigues
Laboratório de Biologia Molecular e Biotecnologia do Curso de Ciências Biológicas; Universidade Federal do Amapá
Rod. Juscelino Kubitschek, Km 2; Jardim Marco Zero
CEP: 68903-419; Macapá-AP, Brazil
e-mail: artemis@unifap.br

INTRODUCTION

The deoxyribonucleic acid (DNA) repair gene XRCC1 (X-ray repair cross complementing family) has an important function in the repair of DNA single-strand breaks induced by oxidation in human cells⁽¹⁾. The deficiencies in DNA repair capacity due to mutations or polymorphisms of repair genes, including XRCC1, can lead to genomic instability, which results in chromosomal instability syndromes and increased risk of various tumor types^{(1, 2)}. These polymorphisms involving an amino acid change in evolutionarily conserved regions can alter the function of XRCC1 protein. Previous studies have reported that allele 399Gln of XRCC1 was significantly associated with high levels of DNA adducts and glycophorin. Mutations in erythrocytes, increased frequency of sister-chromatid exchange and higher sensitivity to the immune response are also associated with this polymorphism⁽¹⁾.

Polymorphisms in DNA repair genes are common events, and some studies have shown the significant effect of many of these polymorphisms in the ability to repair DNA damage, thus influencing individual susceptibility to carcinogenesis^{(3, 4)}.

Cancer may be regarded as a genetic disorder triggered by changes in the cell’s DNA. However, unlike other human genetic diseases, it is not necessarily a hereditary disease. Human cancers are mostly of somatic origin, resulting from the interaction of genetic and environmental factors⁽⁴⁾.

Many changes in DNA are caused by endogenous mutagens, including reactive oxygen species (ROS) and errors during the processes of replication, recombination and repair. At the same time, several changes are the result of DNA interaction with a variety of physical, chemical and biological compounds, many of which are present in the environment, where man can remain in continuous exposure^(4-7).

Among the endogenous factors that influence carcinogenesis one may cite the individual variations in the defense mechanisms, including DNA repair and the detoxification system, and elimination of carcinogens⁽⁷⁾.

Because cancer is a genetic disease, identification and characterization of the genes involved in its origin and progression are of fundamental importance in understanding its molecular basis^{(3, 4, 7)}. This better understanding of the disease contributes to new ways to diagnose it early, thus facilitating treatment^{(3, 4, 7)}.

Our proposal was to determine whether people in Macapá with a diagnosis of cancer have genetic polymorphisms related to the XRCC1 gene.

MATERIAL AND METHODS

Studied samples

Sixty peripheral blood samples were selected: 30 samples from patients (cases) with clinical diagnosis of various cancer types, seen at Hospital de Clínicas Dr. Alberto Lima (HCAL); and 30 blood samples used as control from donors of Instituto de Hematologia e Hemoterapia do Amapá (Hemoap), after informed consent.

Methodological procedure

The DNA of the participants’ samples was isolated by GeneJET Genomic DNA Purification Kit (Synapse Biotechnology), following the manufacturer’s recommended protocol. All samples were amplified and analyzed by polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP) technique, with the use of restriction enzyme MspI^{(1, 6, 7)}. The primers used were: 194F: 5’GCCCCGTCCCAGGTA3′, 194R: 5’AGCCCCAAGACCCTTTCACT 3′, 399F: 5’TTGTGCTTTCTCTGTGTCCA3′, and 399R: 5’TCCTCCAGCCTTTTCTGATA 3′, amplifying the fragments of 491 and 615 bp, respectively (Figure 1). The PCR conditions (25 µl) were 0.5 l of each primer; 300 ng of genomic DNA; 11.5 µl of 2X PCR Taq Master Mix (Molecular Brazil); 11.5 µl H₂O. The amplification cycle consisted of 94ºC for five minutes, thirty cycles of 94ºC for 30 seconds, 65ºC for one minute and 30 seconds, and 72ºC for one minute, followed by five minutes at 72ºC. After the amplification reaction, 10 µl of the PCR product were digested with MspI enzyme (New England BioLabs, Beverly, MA) at 37ºC for one night, and then underwent electrophoresis for identification of the fragment (Figure 2).

Figure 1 – PCR agarose gel at 1.5% for the identification of fragments 491 and 615 bp
M: molecular weight marker (100 bp); B: white; line 1: sample 1; line 2: sample 2; PCR: polymerase chain reaction.

Figure 2 – Standard interpretation of XRCC1 genotype
M: molecular weight marker (100 bp); lines 1, 2 and 3: heterozygous for the Trp allele is homozygous for the Arg allele; line 4: homozygous for the Gln allele is heterozygous for the Trp allele.

DETERMINATION OF GENOTYPE

After amplification and digestion with MspI enzyme, genotyping was characterized by the following fragments: for the 194T polymorphism, the presence of the 292 bp fragment represents the wild-type allele (Arg), while the 313 bp fragment represents the polymorphic allele (Trp), indicating absence of the restriction site of MspI enzyme (Figure 2).

Regarding the polymorphism 399A, Arg/Arg genotype, Arg/Gln and Gln/Gln fragments were identified by 374/221, 615/374/221 and 615 bp, respectively (Figure 2).

RESULTS

The results of the XRCC1 gene frequency in cases and control samples are shown in Table.

Analysis of genetic polymorphisms

In our analysis, we observed that all case samples showed the Trp polymorphic allele (Arg/Trp), as well as 96.6% of the control sample, and one control sample was identified as homozygous for the same Trp allele (Table).

Regarding the polymorphism 399A; 83.3% of the case samples and 23.3% of controls had the Arg/Gln genotype. We found that 73.3% of controls and 16.6% of cases had Arg/Arg genotype. Among the controls, we found only a sample that was homozygous for the polymorphic allele Trp/Trp (Table, Figure 1 and Figure 2).

DISCUSSION

Polymorphisms in DNA repair genes are common events, and some studies have shown the significant effect of many of these polymorphisms in the ability to repair DNA damage, thereby contributing to the difference between individuals⁽⁸⁾.

The XRCC1 protein, encoded by the gene of the same name, is involved in the base excision repair (BER) pathway. This pathway is responsible for identifying and removing the DNA damage (e.g. oxidized, deaminated or alkylated bases) spontaneously arising in the cell or from exposure to exogenous agents, such as ionizing radiation and ultraviolet (UV) light^{(1, 7)}.

It is suggested that polymorphisms in the XRCC1 gene, which cause amino acid changes, would prevent the XRCC1 protein to perform its function effectively and consequently alter the activity of the BER^{(7, 9)}. It has been reported that polymorphisms in repair genes may increase or reduce the susceptibility to the development of cancer and also to treatment with chemotherapeutic agents^{(1, 4, 5, 7, 10)}.

One goal of this study was to analyze the frequency of two polymorphisms of XRCC1 DNA repair gene (194T and 399A), and to investigate their relationship with susceptibility to cancer in people from the city of Macapá.

The single-nucleotide polymorphism (SNP) Arg194Trp is one of the two most frequently observed polymorphisms in the XRCC1 gene. The variant CT and TT genotypes are associated with a risk more than five times higher in female children. Several authors have also identified association of this allele (194T) with the risk of colorectal cancer, nasopharyngeal carcinoma, oral cancer and thyroid cancer^{(7, 10)}.

Our results demonstrated the frequent presence of polymorphic allele 194Trp in both sample groups analyzed. Literature data report that the presence of the variant allele 194Trp is associated with several malignancies⁽¹⁰⁾. Skjelbred et al. (2006)⁽¹⁰⁾ studied 530 samples of Caucasian subjects analyzed by the project Cancer Risk Biomarkers in Norway: only one had the Trp/Trp genotype at codon 194 of the XRCC1 gene, and the majority had the Arg/Arg genotype. In this study we found only a sample of the Trp/Trp genotype among the control samples, and did not identify any with Arg/Arg genotype.

A meta-analysis by Hu et al. (2005)⁽¹¹⁾ assessed the polymorphism in XRCC1 gene (Arg194Trp) susceptibility to various cancer types. In the study, one may observe the existence of conflicting results regarding the Arg194Trp polymorphism for the different ethnic groups investigated. A high frequency of 194T allele was detected in Asians (31.2%; 95% CI 29.6-32.8) and lower frequencies in Europeans (6.6%, 95% CI 5.9-7.4) and Africans (7.3%, 95% CI 5.7-9.2, p < 0.0001).

We observed in this molecular analysis that the 194Trp allele is frequent in people from the city of Macapá, for the Trp allele is present in both cancer cases and controls. The literature reports that the Trp allele shows low frequency among people of African and European descent^(11-13), however, the population of Amapá descends from Africans, Europeans and Indians, what differs from other data reported in the literature. Santos et al. (2009)⁽⁹⁾, in a study in northern Brazil, identified an increasing degree of population substructuring and evidence that this polymorphism differs with respect to ethnic groups. Thus, based on ancestry studies, it is possible that in a particular generation of Amapá population, the Trp allele was maintained and became part of the genetic makeup of these people.

In the present study, we found no correlation between the 194Trp polymorphism and the development of cancer, as all DNA samples from cases and controls had this allele. Another polymorphism of XRCC1 gene analyzed in the present study was the 399A; 73.3% of the control samples and 16.6% of cases were identified with the wild genotype Arg/Arg. However, we found that 83.3% of the samples of cancer cases had the Arg/Gln genotype, a high frequency compared to the frequency of 23.3% of the controls.

Au et al. (2003)⁽¹⁴⁾ reported the interaction of 399Gln XRCC1 gene polymorphism with large deletions in human chromosomes induced by X-ray. Angelini et al. (2005)⁽¹⁵⁾ demonstrated that the gene polymorphism of XRCC1 was positively correlated with the increase in the number of chromosomal abnormalities found in peripheral blood lymphocytes of individuals occupationally exposed to low doses of ionizing radiation.

Studies have reported that individuals with at least one allele 399Gln have increased tendency for chromosomal aberrations⁽¹⁾. In the present study, we found a correlation between cases of cancer and the 399Gln polymorphism. Our results show that probably people with the Arg/Gln genotype show greater susceptibility to the development of some form of cancer. Thus, we can also consider the 399Gln polymorphism a possible genetic marker for use in cancer prognosis, yet it is undoubtedly necessary to increase the number of cases and controls.

For the first time in Macapá, a genetic study was conducted associating a gene polymorphism with the development of cancer. We intend to continue the study, increasing the number of samples. We are in the early stages of a more specific study, which will analyze samples of developed cancer, as well as associate each patient’s genetic results to clinical practice.

REFERENCES

1. Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007;29(2):198-9.

2. Brem R, Hall J. XRCC1 is required for DNA single-strand repair in human cell. Nucleic Acids Res. 2005;33(8):2512-20.

3. Jelonek K, Gdowicz-Klosok A, Pietrowska M, et al. Association between single-nucleotide polymorphisms of selected genes involved in the response to DNA damage and risk of colon, head and neck, and breast cancers in a Polish population. J Appl Genet. 2010;51(3):343-52.

4. Mandal RK, Kapoor R, Mittal RD. Polymorphic variants of DNA repair gene XRCC3 and XRCC7 and risk of prostate cancer: a study from North Indian population. DNA Cell Biol. 2010;29(11):669-74.

5. Lindhal T. Suppression of spontaneous mutagenesis in human cells by DNA base excision-repair. Mutat Res. 2000;462(2-3):129-35.

6. Lunn MR, Langlois RG, Hsieh LL, et al. XRCC1 polymorphism: effects on aflatoxin B1-DNA adducts and glycophorin A variant frequency. Cancer Res. 1999;59(11):2557-61.

7. Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010.

8. Pachkowski GF, Winkel S, Kubota Y, Swenberg JA, Millikan RC, Nakamura J. XRCC1 genotype and breast cancer: functional studies and epidemiologic data show interactions between XRCC1 codon 280 His and smoking. Cancer Res. 2006;66(5):2860-8.

9. Santos NPC, Ribeiro-Rodrigues EM, Ribeiro-dos-Santos AKC, et al. Assessing individual interethnic admixture and population substructure using a 48 insertion-deletion ancestry informative markers panel. Hum Mutat. 2009;31(2):184-90.

10. Skjelbred CF, Svendsen M, Haugen V. Influence of DNA repair gene polymorphisms of hOGG1, XRCC1, XRCC3, ERCC2 and the folate metabolism gene MTHFR on chromosomal aberration frequencies. Mutat Res. 2006;602(1-2):151-62.

11. Hu Z, Ma H, Chen F, Wei Q, Shen H. XRCC1 polymorphisms and cancer risk: a meta-analysis of 38 case-control studies. Cancer Epidemiol Biomarkers Prev. 2005;14(7):1810-8.

12. Canalle R, Andrade V, Scrideli RG, et al. Polymorphisms in the thymidylate synthase promoter and the DNA repair genes XRCC1 and XPD in a Brazilian population. Environ Mol Mutagen. 2006;47(9):725-32.

13. Duarte FL, Colombo J, Rossit ARB, Silva AE. Polymorphism of the DNA repair genes XRCC1 and XRCC3 in a Brazilian population. Genet Mol Biol. 2005;28(3):397-401.

14. Au WW, Salama AS, Sierra-Torres CH. Functional characterization of polymorphism in DNA repair genes using cytogenetic challenge assays. Environ Health. 2003;111(15):1843-50.

15. Angelini S, Kumar R, Carbone F, et al. Micronuclei in humans induced by exposure to low level of ionizing radiation: influence of polymorphism in DNA repair gene. Mutat Res. 2005;570(1):105-17.